denoiser.py – Remove noise from 454 sequencing data¶
Description:
The denoiser removes sequencing noise characteristic to pyrosequencing by flowgram clustering. For a detailed explanation of the underlying algorithm see (Reeder and Knight, Nature Methods 7(9), 2010).
Usage: denoiser.py [options]
Input Arguments:
Note
[REQUIRED]
- -i, --input_files
- Path to flowgram files (.sff.txt), comma separated
[OPTIONAL]
- -f, --fasta_fp
- Path to fasta input file. Reads not in the fasta file are filtered out before denoising. File format is as produced by split_libraries.py [default: None]
- -o, --output_dir
- Path to output directory [default: random dir in ./]
- -c, --cluster
- Use cluster/multiple CPUs for flowgram alignments [default: False]
- -p, --preprocess_fp
- Do not do preprocessing (phase I),instead use already preprocessed data in PREPROCESS_FP
- --checkpoint_fp
- Resume denoising from checkpoint. Be careful when changing parameters for a resumed run. Requires -p option. [default: None]
- -s, --squeeze
- Use run-length encoding for prefix filtering in phase I [default: False]
- -S, --split
- Split input into per library sets and denoise separately [default: False]
- --force
- Force overwrite of existing directory [default: False]
- --primer
- Primer sequence [default: CATGCTGCCTCCCGTAGGAGT]
- -n, --num_cpus
- Number of cpus, requires -c [default: 1]
- -m, --max_num_iterations
- Maximal number of iterations in phase II. None means unlimited iterations [default: None]
- -b, --bail_out
- Stop clustering in phase II with clusters smaller or equal than BAILde [default: 1]
- --percent_id
- Sequence similarity clustering threshold, expressed as a fraction between 0 and 1 [default: 0.97]
- --low_cut_off
- Low clustering threshold for phase II [default: 3.75]
- --high_cut_off
- High clustering threshold for phase III [default: 4.5]
- --low_memory
- Use slower, low memory method [default: False]
- -e, --error_profile
- Path to error profile [default= <qiime-install-path>/qiime/support_files/denoiser/Data/FLX_error_profile.dat]
- --titanium
- Shortcut for -e <qiime-install-path>/qiime/support_files/denoiser/Data//Titanium_error_profile.dat –low_cut_off=4 –high_cut_off=5 . Warning: overwrites all previous cut-off values [DEFAULT: False]
Output:
centroids.fasta: The cluster representatives of each cluster
singletons.fasta: contains all unclustered reads
- denoiser_mapping.txt: This file contains the actual clusters. The cluster centroid is given first,
- the cluster members follow after the ‘:’.
checkpoints/ : directory with checkpoints
Note that the centroids and singleton files are disjoint. For most downstream analyses one wants to cat the two files.
Run denoiser on flowgrams in 454Reads.sff.txt with read-to-barcode mapping in seqs.fna, put results into Outdir, log progress in Outdir/denoiser.log
denoiser.py -i 454Reads.sff.txt -f seqs.fna -v -o Outdir
Multiple sff.txt files:
Run denoiser on two flowgram files in 454Reads_1.sff.txt and 454Reads_2.sff.txt with read-to-barcode mapping in seqs.fna, put results into Outdir, log progress in Outdir/denoiser.log
denoiser.py -i 454Reads_1.sff.txt,454Reads_2.sff.txt -f seqs.fna -v -o Outdir
Denoise multiple library separately:
Run denoiser on flowgrams in 454Reads.sff.txt with read-to-barcode mapping in seqs.fna, split input files into libraries and process each library separately, put results into Outdir, log progress in Outdir/denoiser.log
denoiser.py -S -i 454Reads.sff.txt -f seqs.fna -v -o Outdir
Resuming a failed run:
Resume a previous denoiser run from breakpoint stored in Outdir_from_failed_run/checkpoints/checkpoint100.pickle. The checkpoint option requires the -p or –preprocess option, which usually can be set to the output dir of the failed run. All other arguments must be identical to the failed run.
denoiser.py -i 454Reads.sff.txt -f seqs.fna -v -o Outdir_resumed -p Outdir_from_failed_run --checkpoint Outdir_from_failed_run/checkpoints/checkpoint100.pickle

